بررسی بیان فاکتورهای رونویسی WRKY در شرایط تنش شوری در گندم نان (Triticum aestivum)

نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه زراعت و اصلاح نباتات، دانشکده کشاورزی، دانشگاه کردستان

2 گروه زراعت و اصلاح نباتات، دانشکده کشاورزی، دانشگاه کردستان، سنندج

چکیده

اصلاح ژنتیکی برای تحمل به شوری یکی از روشهای موثر اصلاحی برای گندم است. اما درک ﺳﺎزوﮐﺎر، مطالعه و شناسایی ژنهای ﺗﺤﻤﻞ به ﺷﻮری پیش نیاز اصلاح ژنتیکی است. نقش تعدادی از خانواده‌های عوامل رونویسی در پاسخ به تنشهای محیطی ثابت شده است، بنابراین شناسایی و مطالعه آنها امکان غلبه بر تنش‌های موجود مانند شوری را تسهیل می کند. با توجه به نقش موثرخانواده مهم فاکتور رونویسی WRKY در تقابل با تنشها، میزان بیان دو ژن مهم این خانواده از جملهTaWRKY10 و TaWRKY53 در ارقام مقاوم و حساس به شوری در گندم در مرحله 3 تا 4 برگی بررسی شد. نتایج نشان داد که ژن TaWRKY10 در ارقام گندم حساس (تجن) و مقاوم (بم) به شوری دارای بیان متفاوتی است، ولی در رقم بم در شرایط تنش شوری در طی یک دوره 48 ساعتی، دارای بیان بیشتری هم در برگ و هم در ریشه نسبت به شاهد و نیز نسبت به رقم تجن است. هر چند بیان TaWRKY53 در ارقام مقاوم و حساس متفاوت بود، اما این ژن در رقم حساس با گذشت زمان، بیان بیشتری نسبت به شاهد و رقم مقاوم در برگ و ریشه نشان داد. همچنین کاربرد اسید سالیسیلیک نیز در شرایط تنش شوری باعث تغییر در بیان این ژنها در این ارقام شد. به طور کلی نتایج به دست آمده نشان می دهد که فاکتورهای رونویسی WRKY می توانند در ایجاد مقاومت به تنش شوری در گندم نقش ایفا کنند و بنابراین در اصلاح ژنتیکی مورد استفاده قرار گیرند.

کلیدواژه‌ها


عنوان مقاله [English]

Analysis of expression of WRKY transcription factors under saline conditions in bread wheat (Triticum aestivum)

نویسندگان [English]

  • Asad Maroufi 1
  • Saeed Ahadi 2
  • Bahman Bahramnejad 2
  • Adel Siosemardeh 2
1 Department of Agronomy and Plant Breeding, Faculty of Agriculture, University of Kurdistan, Sanandaj, Iran
2 Department of Agronomy and Plant Breeding, Faculty of Agriculture, University of Kurdistan, Sanandaj, Iran
چکیده [English]

Genetically improvement for salinity resistance is one of the most effective breeding methods for wheat. But understanding the mechanism, assessing and identifying salinity tolerance genes is a prerequisite for genetic modification. The role of a number of families of transcription factors has been proven in response to environmental stresses, hence, their identification and investigation facilitates the possibility of overcoming stresses. Considering the significant role of the important family of WRKY transcription factors in response to stresses, the expression of two important genes of this family including TaWRKY10 and TaWRKY53 in different tolerant and susceptible cultivars of wheat was investigated. The results showed that TaWRKY10 exhibited different expressions in susceptible wheat (Tajan) and resistant (Bam) cultivars. In resistant cultivar (Bam) under saline conditions over a period of 48 hours, TaWRKY10 showed more expression level in both leaf and root tissues than the control and also the sensitive (Tajan) cultivar. However, the expression of TaWRKY53 was different in resistant and susceptible cultivars. TaWRKY53 in susceptible cultivar (Tajan), over the period of 48 hours, showed more expression level than the control and resistant cultivar (Bam) in leaves and root tissues. Also, by using salicylic acid under salinity stress, the expressions of TaWRKY10 and TaWRKY53 in Tajan and Bam cultivars were different. In general, our results show that WRKY transcription factors can play a role in generating resistance to salinity stress in wheat and therefore can be used in genetic improvement.

کلیدواژه‌ها [English]

  • Wheat
  • Genetic improvement
  • Salinity stress
  • Resistance

مقدمه

در بین غلات، گندم یکی از مهم‌ترین گیاهان زراعی مورد استفاده برای غذای انسان است. گندم متعلق به خانواده گرامینه (گندمیان) و یکی از قدیمی­ترین گیاهان به شمار می­رود (Shewry, 2009). گندم معمولی یا همان گندم نان  (Triticum aestivum) بیشترین میزان کشت را در بین انواع گونه‌های گندم داراست و اهمیت مطالعه و بررسی بر روی آن با توجه به افزایش جمعیت و تهدیدهای زیستی بیش از گذشته است  (Shewry, 2009). گندم در دوره رشد با انواع تنش‌های زنده و غیر زنده مواجه می‌شود که نمو، رشد و به ویژه عملکرد را محدود می‌کنند. تنش شوری یک عامل اساسی و محدود کننده در کاهش عملکرد بسیاری از محصولات زراعی از جمله گندم در دنیا و ایران می‌باشد. غلظت­های بالای نمک در محیط ریشه گیاهان، تنش‌های اسمزی را به وجود می­آورد که از جذب و انتقال آب جلوگیری می‌کند. همچنین افزایش شوری خاک و آب موجب افزایش نمک در گیاه و در نتیجه سمیت یونی درون سلول‌ها می‌شود (Xiaomu et al., 1995). شوری برتمام فرایندهای اصلی گیاه مانند رشد، فتوسنتز، سنتز پروتئین، متابولیسم لیپید و انرژی موثر بوده، درنتیجه تمام مراحل زندگی گیاه از جوانه­زنی تا تولید زیست توده و عملکرد دانه را تحت تأثیر قرار می­دهد (Parida et al., 2004). در مقابل، در شرایط تنش گیاهان مجبورند مراحل اساسی رشد خود را انجام دهند و از بدین منظور از راهکارهای متنوعی استفاده کنند. گیاهان در مقابله با شوری راهبردهایی دارند که منجر به افزایش تولید و بهبود مقاومت در آنها می‌شود. این راهبردها شامل تجمع انتخابی یا خروج یون‌ها،کنترل جذب یونها توسط ریشه و انتقال یونها به برگ،کده­بندی یونها در سلولها و یا در همه بخشهای گیاه، ایجاد آبکش سازمان نیافته، افزایش نشت مواد از غشای پلاسمایی، سنتز ترکیبات سازگار، القای آنزیم‌های آنتی‌اکسیداتیو، القای هورمون‌های گیاهی، حذف نمک­ها با غدد نمکی، ترشحو برون تراوی نمک‌ها از طریق غدد نمکی و رقیق ­سازی نمک با آبدار شدگی می‌باشند (Prasad, 1996). بسیاری از این عکس العمل‌های گیاهان در سطح مولکولی کنترل می‌شود،  گیاهان با تغییر الگوی بیان ژن‌های مرتبط با تنش برای کاهش آسیب تنش و نیز هموستازی دوباره یون و آب پاسخ می‌دهند (Apel and Hirt, 2004)، که دارای اهمیت ویژه­ای برای ایجاد مقاومت گیاه نسبت به تنش شوری می‌باشد. انتقال دهنده­های یونی مختلفی تعیین کننده میزان نهایی هموستازی یونی هستند که در سطح رونویسی و پس از رونویسی تنظیم می‌شوند (Apel and Hirt, 2004). با توجه به وسعت بالای اراضی تحت تأثیر نمک در جهان ضرورت شناخت کامل مکانیسم‌های ژنتیکی به خوبی احساس می‌شود. استفاده از ارقام مقاوم به شوری یکی از مهم‌ترین روش‌های مؤثر در بهره­برداری و افزایش عملکرد در زمین­های شور و نسبتاً شور به حساب می­آید (FAO, 2008). با توجه به وجود تنش شوری در مناطق وسیعی از ایران شناسایی، جداسازی، بررسی تغییرات بیان و انتقال ژن‌های عامل مقاومت به تنش شوری به گیاهان زراعی از جمله گندم، امکان افزایش سطح زیر کشت گیاهان و در نتیجه افزایش تولید را فراهم می­آورد.

فاکتورهای رونویسی برای تنظیم بیان ژن‌ها ضروری هستند، بنابراین در تمامی موجودات زنده وجود دارند. تعداد عوامل رونویسی در هر موجود زنده بستگی به اندازه ژنوم آن دارد. بنابراین هرچه اندازه ژنوم بزرگتر باشد در نتیجه تعداد عامل رونویسی بیشتری هم وجود دارد (Nimwegen, 2003). بسته به نوع عامل رونویسی بعد از اتصال عامل رونویسی به نواحی مرتبط در ژن‌های تحت کنترل، بیان آنها کم یا زیاد می‌شود و مکانیسم­های متفاوتی برای تنظیم بیان ژن دارند. بسیاری از خانواده‌های عوامل رونویسی در پاسخ به تنش‌های محیطی نقش دارند، بنابراین می‌توانند امکانی را برای گیاهان فراهم کنند تا بر تنش‌های موجود از جمله شوری غلبه کنند (Rahaie et al., 2011). عوامل رونویسی WRKY یکی از بزرگترین سوپرخانواده­های تنظیم کننده رونویسی در گیاهان می‌باشند که در تنظیم بسیاری از فرایند­های زیستی شرکت می‌کنند. نام این خانواده از چهار اسید آمینه حفاظت شده آن شامل tryptophan (W)، arginine (R)، lysine (K) و tyrosine (Y)  گرفته شده است. خانواده ژنی WRKY یکی از ده خانواده بزرگ ژنی هستند که در گیاهان عالی و تمام اجداد سبز گیاهی کشف شده‌اند (Eulgem et al., 2000). این خانواده ژنی در طی تکامل گسترش پیدا کرده­اند و احتمالا همراه با توسعه و تکامل، خود را با پیچیدگی­های زیاد مکانیسم­های دفاعی عوامل زنده و غیر زنده وفق داده­اند (Eulgem and Somssich, 2007). یافته­های جدید نشان می‌دهد که پروتئین‌های مربوط به خانواده WRKY اغلب به عنوان فعال کننده­ها و مهارکننده­هایی در فرایندهای مهم گیاهی شرکت می‌کنند. عوامل رونویسی WRKY کلیدهای تنظیمی هستند که هم فعالیت‌های تنظیمی مثبت و هم فعالیت‌های تنظیمی منفی دارند (Eulgem and Somssich, 2007). یکی از مهم‌ترین فیتوهورمون‌ها که نقش مهمی در نشان دادن مقاومت به تنش‌های زیستی و غیرزیستی در گیاهان دارد، سالیسیلیک اسید می‌باشد. سالیسیلیک اسید یا اورتو هیدروکسی بنزوئیک اسید، یک تنظیم کننده رشد درونی گیاهی می‌باشد که از گروه ترکیبات فنلی طبیعی است و در تنظیم فرآیندهای فیزیولوژیکی و بیوشیمیایی گیاه نقش دارد (Bezrukova et al., 2001) همچنین یکی از اثرات تنش‌های محیطی از جمله شوری، افزایش گونه‌های فعال اکسیژن و القای تنش اکسیداتیو است (Hoekstra et al., 2001). این نوع اکسیژن، سمی و بسیار فعال بوده و در غیاب هر مکانیسم محافظتی، متابولیسم معمولی سلول را از طریق آسیب اکسیداتیو تحت تاثیر قرار می‌دهد. یکی از موارد آسیب آن پراکسیداسیون لیپیدهای غشاست که نتیجه آن تخریب پروتئین‌ها، غیر فعال شدن آنزیم‌ها، از بین رفتن رنگدانه‌ها و تخریب رشته‌های DNA است (El-Tayeb, 2005). سالیسیلیک اسید در هنگام مواجهه گیاه با تنش‌های محیطی باعث فعال شدن سیستم آنتی‌اکسیداتیو در گیاه شده و می‌تواند باعث تقویت غشای سلولی و خنثی کردن خطر افزایش مقدار اکسیژن فعال در مدت زمانی که گیاه در معرض تنش قرار گرفته است، شود  (El-Tayeb, 2005). با توجه به اهمیت فاکتورهای رو نویسی، بررسی بیان آن‌ها در شرایط تنش شوری و فعال شدن سیستم آنتی‌اکسیداتیو توسط  سالیسیلیک اسید می‌تواند باارزش باشد، تا اطلاعات حاصل از آن در راستای اصلاح و انتخاب گیاهان مقاوم به تنش شوری مورد استفاده قرار گیرد. زیرا مطالعات نشان داده اند که عوامل رونویسی مانند bZIP، bHLH، WRKY، MYB، DREB  و عناصر دخیل در انتقال پیام مانند پروتئین کینازهای وابسته به کلسیم (MAP کینازها) در کنترل تنظیم میزان بیان بسیاری از پروتئین‌های عملکردی نقش دارند و از مهم‌ترین تنظیم کننده‌های کنترل ژن‌ها می‌باشند (Rushton et al., 2010; Nakashima et al., 2009; Pearson et al., 2001). مطالعه این ژن‌ها مانند WRKYها به عنوان یک خانواده مهم امروزه یکی از ابزارهای مولکولی جهت دسترسی به سطوح پاسخ گیاهان به شرایط تنش‌های محیطی از جمله شوری می‌باشد. بررسی این گونه ژن‌ها در غلات و آرابیدوپسیس نقش آنها را به خوبی نشان داده است (Nakashima  et al., 2009). دراین تحقیق جهت درک توانایی گندم در تحمل تنش شوری در ارتباط با چند عامل رونویسی WRKY، مطالعه بیان آنها در شرایط تنش شوری و همچنین تاثیر سالیسیلیک اسید بر تغییر بیان آنها در فواصل زمانی پس از اعمال تیمار در دو رقم حساس و متحمل به شوری از گندم مورد بررسی قرار گرفت.

 

مواد و روش‌ها

مواد گیاهی، اعمال تنش شوری و نمونه‌برداری

بذور ارقام بم (مقاوم به شوری) و تجن (حساس به شوری) از مرکز تحقیقات و اصلاح نهال و بذر کرج تهیه و در گلخانه­ دانشکده کشاورزی دانشگاه کردستان در گلدان­های پلاستیکی بزرگ کشت گردید. خاک گلدان‌ها شامل خاک مزرعه، ماسه و خاکبرگ به نسبت مساوی بود. در هر گلدان 10 بذر سالم ضدعفونی شده با هیپوکلریت سدیم 5 درصد کشت شد و بعد از ظهور گیاهچه­ها، 5 گیاه سالم نگهداری شد. گیاهان در شرایط رشدی 16 ساعت روشنایی و 8 ساعت تاریکی و در دمای 2±25 درجه سانتی‌گراد پرورش یافتند. آبیاری تا زمان اعمال تنش با توجه به ظرفیت زراعی برای همه گلدان‌ها به صورت یکسان انجام شد. آزمایش­های انجام­شده در قالب طرح کاملا تصادفی با 3 تکرار طراحی شدند. در یک آزمایش جداگانه جهت مطالعه بیان ژن‌ها، ارقام بم و تجن در مرحله 3 تا 4 برگی در دو سطح صفر (شاهد) و غلظت­ 170 میلی­مولار کلرید سدیم آبیاری شدند. آبیاری تیمار شاهد با آب بدون کلرید سدیم انجام شد. در یک آزمایش دیگر نیز، ارقام مورد آزمایش در مرحله 3 تا 4 برگی با غلظت­ 170 میلی­مولار کلرید سدیم آبیاری شدند اما هم زمان با غلظت 1/0 میلی­مولار سالیسیلیک اسید  نیز محلولپاشی شدند و تیمار شاهد (سطح صفر) تنها آب بدون کلرید کلسیم بود. نهایتا از برگ و ریشه گیاهان تیمار شده و شاهد در هر دو طرح به صورت مجزا در زمان‌های 0، 12، 24 و 48 ساعت بعد از اعمال تیمار نمونه­گیری انجام گرفت. تا زمان استخراج RNA  در دمای منفی 80 درجه سانتی‌گراد نگهداری شدند.

استخراج  RNA

برای استخراج RNA کل از برگ و ریشه، از محلول RNAXTM_PLUS شرکت سیناژن طبق پروتکل همراه استفاده شد. جهت حذف DNA از RNA استخراج شده از آنزیم DNase I شرکتFrementas   طبق دستورالعمل شرکت سازنده استفاده شد. همچنین سنتز cDNA  با استفاده از کیت شرکت Vivantis طبق دستورالعمل مربوطه نجام شد.

طراحی آغازگرها و RT-PCR نیمه­کمی

آغازگر­های اختصاصی مستقیم و معکوس برای ژن­ TaActin به ­عنوان ژن رفرنس با شماره دسترسی AB181991.1در پایگاه داده NCBI)، TaWRKY10 (با شماره دسترسی HQ700327.1) و TaWRKY53 (با شماره دسترسی EF368357.1) با استفاده از نرم­­افزار تحت وبPrimer3  (Untergasser et al., 2012) طراحی شدند. از نرم­افزار تحت وب Oligo calc (Kibbe, 2007 ) نیز جهت بررسی آنالیزهای ترمودینامیکی مانند دمای اتصال و دایمر استفاده شد. مشخصات آغازگرهای طراحی شده در جدول 1 ارائه شده است. بیان  ژن‌ها به روش نیمه­کمی مورد بررسی قرار گرفت. نسبت­‌های به‌کار رفته و چرخه‌­های حرارتی مربوط به هر کدام از ژن‌ها در جدول 2 آورده شده است. برای اندازه‌گیری بیان ژن‌ها به صورت نیمه کمی ابتدا آزمایش‌های مقدماتی جهت تعداد مناسب چرخه‌ها و دمای بهینه اتصال پرایمرها با استفاده از گرادیان چرخه‌ها و دما انجام شد. بهترین شرایط تکثیر تعداد 30 چرخه تعیین شد که بر اساس نرسیدن به وضعیت ثابت در تکثیر محصولات PCR بود. محصولات حاصل از واکنشRT-PCR  روی ژل آگارز 2/1 درصد بررسی شدند. سپس ژل‌ها در ظرف حاوی اتیدیوم بروماید (با غلظت 5/0 می‌کروگرم در میلی‌لیتر رقیق شده در آب مقطر) به مدت 15 دقیقه قرار داده شدند. بعد از شستن ژل در آب مقطر، از آنها توسط دستگاه ژل داکیومنت عکس‌برداری انجام شد.

 

 

جدول 1- توالی و دمای اتصال مربوط به آغازگرهای ژن‌های مورد مطالعه

Table 1- Primer sequence and annealing temperature of the studied genes

آغازگر

Primers

توالی آغازگر

Primer sequence

دما

Temperature

F- TaActin

GCTTCCTCATGCTATCCTTC

ºC5/56

R- TaActin

CCAGGAACTTCCATACCAAC

ºC9/56

F- TaWRKY10

GGCTTCGCTAGGACTTACC

ºC6/56

R- TaWRKY10

CGTAGGTGGTGAGGACGTA

ºC57

F- TaWRKY53

CCTTTCAGCAGGATGAGGTC

ºC8/59

R- TaWRKY53

ACCTTCTGCCCGTACTTCCT

ºC1/60

F- پرایمر فوروارد (مستقیم)، R- پرایمر رورس (معکوس)، melting temperature = (Tm)

F=Forward, R=Reverse, (Tm)=melting temperature

 

جدول 2- چرخه‌های حرارتی واکنش RT-PCR برای ژن‌های مورد بررسی

Table 2- RT-PCR thermal cycling for the studied genes

تعداد چرخه            

Cycle number

مرحله

Phase

زمان

Time

دما

Temperature (ºC)

1

واسرشت اولیه

5 دقیقه

94

 

واسرشت

45 ثانیه

94

30

اتصال

45 ثانیه

* بسته به نوع ژن

 

بسط

55 ثانیه

72

1

بسط نهایی

5 دقیقه

72

* دمای اتصال برای ژن­TaActin 60 درجه سانتی‌گراد، TaWRKY10  58 درجه سانتی‌گراد و برایTaWRKY5361 درجه سانتی‌گراد

* Annealing temperature for TaActin is 60 ° C, TaWRKY10 58 ° C and for TaWRKY53 61 ° C


آنالیز بیان ژن و تجزیه و تحلیلآماری

نتایج حاصل از RT-PCR نیمه­کمی که به صورت عکس تهیه شدند با استفاده از نرم­افزار GelQuantNET biochemlabsolutions.com   به داده‌های کمی تبدیل شدند. ژن اکتین (TaActin) به عنوان ژن رفرنس انتخاب شد. تجزیه واریانس بر اساس طرح اجرا شده با استفاده از نرم­افزار SPSS انجام شد و در پایان مقایسه میانگین داده‌های حاصل توسط آزمون دانکن در سطح احتمال 5 درصد صورت گرفت. نمودارهای مناسب توسط نرم­افزار Microsoft Excel 2013 جهت تجزیه و تحلیل بیان ژن‌ها رسم گردید.

 

 

 

 

نتایج و بحث

استخراج  RNA، سنتز cDNA و واکنش‌های RT-PCR

استخراج RNA با کمیت و کیفیت مناسب از بافت برگ و ریشه ارقام بم و تجن با استفاده از کیت سیناژن انجام شد. میانگین غلظت RNA استخراج شده 6/0 می‌کروگرم بر می‌کرولیتر و نسبت طول موج 260 به 280  برای تمامی نمونه‌ها بین 7/1 تا 9/1 بود. پس از سنتز cDNA، واکنش RT-PCR نیمه­کمی برای  هرسه ژن انجام شد (شکل 1 و 2) و نوارهای به دست آمده برای ژن‌های  TaWRKY53 و TaWRKY10به کمک ژن اکتین (TaActin) نرمال سازی شد. داده‌های بیان ژن در بافت‌های ریشه و برگ گیاهان در دو آزمایش جداگانه تحت تیمار کلرید سدیم به تنهایی و کلرید سدیم و سالیسیلیک اسید هم زمان به دست آمد که نتایج به شرح زیر است.

 

 

 

شکل 1- واکنش‌های RT-PCR جهت بررسی الگوی بیان ژن­  TaWRKY10در بافت برگ و ریشه ارقام بم و تجن گندم پس از تیمار با 170 میلی­مولار سدیم کلرید. (BL) بافت برگ رقم بم، (BR) بافت ریشه رقم بم، (TL) بافت برگ رقم تجن، (TR) بافت ریشه رقم تجن، (1 تا4) به ترتیب 0، 12، 24 و 48 ساعت پس از اعمال تیمار، (N.C) کنترل منفی، M اندازه نمای 1500 بازی DNA  وActin ژن رفرنس.

Figure 1- RT-PCR reactions to study the expression patterns of TaWRKY10 in leaf and root tissues of Bam and Tajan cultivars after treatment with 170 mM NaCl. (BL) leaf tissue of Bam cultivar, (BR) root tissue of Bam cultivar, (TL) leaf tissue of Tajan, (TR) root tissue of Tajan, (1 to 4) 0, 12, 24 and 48 hours after treatment respectively, (NC) Negative Control, M 1500 bp DNA Marker and Actin, Reference Gene.

 

 

شکل 2- واکنش‌های RT-PCR جهت بررسی الگوی بیان ژن­ TaWRKY53 در بافت برگ و ریشه ارقام بم و تجن گندم پس از تیمار با 170 میلی­مولار سدیم کلرید. (BL) بافت برگ رقم بم، (BR) بافت ریشه رقم بم، (TL) بافت برگ رقم تجن، (TR) بافت ریشه رقم تجن، (1 تا4) به ترتیب 0، 12، 24 و 48 ساعت پس از اعمال تیمار، (N.C) کنترل منفی، (M) اندازه نمای DNA  و Actin ژن رفرنس.

Figure 2- RT-PCR reactions to study the expression patterns of TaWRKY53 in leaf and root tissues of Bam and Tajan cultivars after treatment with 170 mM NaCl. (BL) leaf tissue of Bam cultivar, (BR) root tissue of Bam cultivar, (TL) leaf tissue of Tajan, (TR) root tissue of Tajan, (1 to 4) 0, 12, 24 and 48 hours after treatment respectively, (NC) Negative Control, M 1500 bp DNA Marker and Actin, Reference Gene.

 


بیانژن TaWRKY10 تحت تیمار کلرید سدیم

الگوی بیان  ژن TaWRKY10 تحت تأثیر تیمار با سدیم کلرید 170 میلی­مولار (شکل 1) و نتایج حاصل از تجزیه و تحلیل آماری برای ژن  مذکور نشان داد که در رقم مقاوم (بم)، در هر دو بافت برگ و ریشه میزان بیان بعد از 12 ساعت نسبت به تیمار شاهد (سطح صفر) به طور معنی‌داری (سطح احتمال 05/0>P) افزایش نشان داد ولی با گذشت زمان بعد از 24 و 48 ساعت پس از اعمال تیمار میزان بیان به سطح تیمار شاهد برگشت. برای این ژن بیشترین میزان آن در برگ بعد از 12 ساعت (7/3 برابر نسبت به شاهد) و در ریشه نیز بعد از 12 ساعت (4/2 برابر نسبت به شاهد) پس از اعمال تیمار شوری مشاهده گردید (شکل 3 الف). در رقم حساس (تجن) بیان ژن مذکور در هر دو بافت برگ و ریشه روندی کاهشی را نشان داد، به طوری که کمترین مقدار آن در برگ بعد از 24 ساعت و در ریشه نیز بعد از 12 ساعت پس از اعمال تیمار دیده شد  (شکل 3 ب).


 

شکل 3-  نمودار میزان بیان ژن TaWRKY10 در بافت برگ و ریشه در 0، 12، 24 و 48 ساعت پس از اعمال تیمار 170 میلی­مولار سدیم کلرید. (الف) رقم بم، (ب) رقم تجن.  مقادیر میانگین 3 تکرار می‌باشد. حروف یکسان اختلاف معنی‌داری در سطح احتمال 5 درصد با هم ندارند.

Figure 3- Level of expression of TaWRKY10 in leaf and root tissues at 0, 12, 24 and 48 hours after 170 mM NaCl treatment. (a) Bam, (b) Tajan. The values are the mean of 3 replicates. Means with the same letters are not significantly different at 5 percent level.

 

 

بیانژن TaWRKY53تحت تیمار کلرید سدیم

نمودار الگوی بیان  ژن TaWRKY53تحت تأثیر تیمار با سدیم کلرید 170 میلی­مولار در شکل 4 نشان داده شده است. نتایج حاصل از تجزیه و تحلیل آماری برای ژن  TaWRKY53نیزنشان داد که تیمار سدیم کلرید 170 میلی­مولار در رقم مقاوم (بم)، تأثیر معنی‌داری بر بیان این ژن ندارد (شکل 4 الف). ولی در رقم حساس (تجن) افزایش معنی‌داری نسبت به شاهد در هر دو بافت پس از گذشت 12 ساعت روی داد (شکل 4 ب)، به طوری که بیشترین میزان بیان در برگ بعد از 12 ساعت (6/3 برابر نسبت به شاهد) و در ریشه بعد از 24 ساعت (3/1 برابر نسبت به شاهد) پس از اعمال تیمار  مشاهده شد (شکل 4 ب).


 

 

شکل 4-  نمودار میزان بیان ژن TaWRKY53در بافت برگ و ریشه در 0، 12، 24 و 48 ساعت پس از اعمال تیمار 170 میلی­مولار سدیم کلرید. (الف) رقم بم، (ب) رقم تجن.  مقادیر میانگین 3 تکرار می‌باشد. حروف یکسان اختلاف معنی‌داری در سطح احتمال 5 درصد با هم ندارند.

Figure 4- Level of expression of TaWRKY53 in leaf and root tissues at 0, 12, 24 and 48 hours after 170 mM NaCl treatment. (a) Bam, (b) Tajan. The values are the mean of 3 replicates. Means with the same letters are not significantly different at 5 percent level.

 

بیانژن TaWRKY10 تحت تیمار همزمان سالیسیلیک اسید و کلرید سدیم

نتایج حاصل از تجزیه و تحلیل آماری داده‌های بدست آمده نشان داد که بیان ژن TaWRKY10در اثر تیمار همزمان سالیسیلیک اسید و سدیم کلرید در رقم مقاوم (بم) پس از اعمال تنش روند افزایشی را نشان می­دهد (شکل 5 الف)، به طوری که بیشترین میزان بیان بعد از 24 ساعت پس از اعمال تیمار مشاهده شد که حدود 2 برابر نسبت به شاهد بود. ولی در رقم حساس (تجن) تغییرات معنی‌داری در بیان ژن مذکور مشاهده نگردید (شکل 5 ب). در رقم تجن میزان بیان ژن TaWRKY10 تحت تیمار همزمان سالیسیلیک اسید و سدیم کلرید نیز بیشتر از حالت تیمار با سدیم کلرید به تنهایی بود  (شکل 5 ب) ولی در رقم بم میزان بیان تحت تیمار همزمان پس از گذشت 12 ساعت یعنی در ساعات 24 و 48 بیشتر از حالت تیمار تنها با سدیم کلرید بود (شکل 5 الف).

 

 

 

شکل 5- نمودار روند میزان بیان ژن TaWRKY10 در بافت برگ در 0، 12، 24 و 48 ساعت پس از اعمال تیمار همزمان 1/0 میلی­مولار سالیسیلیک اسید و 170 میلی­مولار سدیم کلرید. (الف) رقم بم، (ب) رقم تجن.  مقادیر میانگین 3 تکرار می‌باشد. حروف یکسان اختلاف معنی‌داری در سطح احتمال 5 درصد با هم ندارند.

Figure 5- Trend of TaWRKY10 expression in leaf tissue at 0, 12, 24 and 48 hours after simultaneous treatments with 0.1 mM salicylic acid and 170 mM sodium chloride. (a) Bam, (b) Tajan. The values are the mean of 3 replicates. Means with the same letters are not significantly different at 5 percent level.

 

 

بیانژنTaWRKY53  تحت تیمار همزمان سالیسیلیک اسید و کلرید سدیم

 

نتایج بررسی بیان ژن TaWRKY53 در اثر تیمار همزمان سالیسیلیک اسید و سدیم کلرید نشان داد که در رقم مقاوم (بم) پس از 12 ساعت روند کاهشی و پس از 24 و 48 ساعت دوباره به ­سطح شاهد رسید (شکل 6 الف). ولی در رقم حساس در همه زمان‌ها سطح بیان ژن تقریبا ثابت بود (شکل 6 ب). در رقم تجن سطح بیان ژن TaWRKY53 تحت تیمار همزمان سالیسیلیک اسید و سدیم کلرید درمقایسه با حالت تیمار با سدیم کلرید به تنهایی کمتر بود (شکل 6 ب)، ولی در رقم بم اختلاف قابل ملاحظه‌ای در سطح بیان دو نوع تیمار مشاهده نگردید (شکل 6 الف).

 

 

 

 

 

 

 

 

 

 

 


 

شکل 6- نمودار روند میزان بیان ژن TaWRKY53 در بافت برگ در 0، 12، 24 و 48 ساعت پس از اعمال تیمار همزمان 0.1 میلی­مولار سالیسیلیک اسید و 170 میلی‌مولار سدیم کلرید. (الف) رقم بم، (ب) رقم تجن.  مقادیر میانگین 3 تکرار می‌باشد. حروف یکسان اختلاف معنی‌داری در سطح احتمال 5 درصد با هم ندارند.

Figure 6- Trend of TaWRKY53 expression in leaf tissue at 0, 12, 24 and 48 hours after simultaneous treatments with 0.1 mM salicylic acid and 170 mM sodium chloride. (a) Bam, (b) Tajan. The values are the mean of 3 replicates. Means with the same letters are not significantly different at 5 percent level.

 

 

تنش‌ها محدودیت یا نوسانات غیر قابل پیش­بینی هستند که بر روی الگوی عادی متابولیکی گیاه تحمیل می‌شوند و باعث صدمه یا بیماری می­گردند (Gaspar et al., 2002). شناسایی ژن‌های موثر و تعیین الگوی بیان آنها در پاسخ به انواع تنش‌ها موجب می‌شود تا راهکارهای مؤثری در اصلاح گیاهان جهت بهبود تحمل به تنش ایجاد گردد (Cushman and Bohnert, 2000). در سال‌های اخیر با در اختیار داشتن روش‌های مطالعه بیان ژن، توجه بسیاری از محققین به مقایسه الگوی بیان ژن‌ها در گیاهان متحمل و حساس به تنش‌های زنده و یا غیر زنده جلب شده است. از جمله ژن‌های تنظیمی درگیر در پاسخ به تنش‌ها، عوامل رونویسی هستند که نقش مهمی را در پاسخ به تنش‌ها در گیاهان مختلف ایفا می‌کنند که یکی از مهم‌ترین آنها خانواده ژنی WRKY می‌باشد. فاکتورهای رونویسی WRKY جزو خانواده بزرگی در گیاهان عالی محسوب می‌شوند که نقش مهمی در رشد، متابولیسم و پاسخ به تنش‌های زنده و غیرزنده ایفا می‌کنند (Zhou et al., 2008). در مطالعات انجام شده توسط Zhou همکاران (2008) گزارش شده است که ژن GmWRKY54مقاومت به شوری را در گیاه آرابیدوپسیس القاء می‌کند. همچنین Wang  و همکاران (2013) با بررسی الگوی بیان فاکتور رونویسی TaWRKY10 گندم در گیاه تراریخت توتون نشان دادند که این ژن با تعدیل اسمزی و تأثیر بر رونویسی ژن‌های وابسته به تنش، یک فاکتور مؤثر در فرایند مقاومت به شوری محسوب می‌شود. در این پژوهش نیز الگوی بیان ژن‌های TaWRKY10 و TaWRKY53 نشان داد که ژن TaWRKY10در شرایط تنش شوری در رقم مقاوم تر گندم (بم)، در هر دو بافت برگ و ریشه نسبت به تیمار شاهد بعد از 12 ساعت به طور معنی‌داری افزایش بیان پیدا کرد ولی با گذشت زمان بعد از 24 ساعت پس از اعمال تنش به سطح شاهد رسید. همچنین در رقم حساس تر (تجن) کاهش معنی‌داری در میزان بیان ژن مذکور در هر دو بافت مشاهده شد. این نتایج با مشاهداتWang   و همکاران (2013) مطابقت دارد. همچنین میزان بیان ژن TaWRKY53در رقم حساس تر به شوری (تجن) به صورت معنی‌داری افزایش یافت ولی در رقم مقاوم (بم) تأثیر معنی‌داری در الگوی بیان این ژن مشاهده نگردید. بنابراین به نظر می‌رسد ژن TaWRKY53 تأثیر معکوس را در مقاومت به شوری در گندم دارد،  که شاید به دلیل رابطه متقابل ژن‌های القاء شونده در شرایط تنش از جمله ژن TaWRKY18 و یا سایر ژن‌ها با ژن TaWRKY53در رقم مقاوم باشد. همچنین گزارش شده است که ژن WRKY53در فرایند پیری نقش دارد (Ay et al., 2009; Miao and Zentgraf, 2010) و بیان آن در شرایط تنش، مخصوصاً در ژنوتیپ‌های حساس به تنش افزایش می‌یابد (Ishihama and Yoshioka, 2012). در مطالعه روی گیاه آرابیدوپسیس نیز نتایج نشان داده شده است که بیش بیان ژن WRKY53تأثیر منفی در مقاومت به تنش‌های محیطی از جمله شوری و خشکی دارد Sun and Yu, 2015)). بنا براین الگوی متفاوت بیان ژن مذکور نسبت به ژن‌های دیگر در ارقام مقاوم و حساس گندم احتمالاً می‌تواند ناشی از نقش متفاوت این ژن باشد. به نظر می‌رسد که TaWRKY10در گندم نقش مهم تری در مقاومت به شوری ایفا می‌کند.

سالیسیلیک اسید یکی از هورمون‌های گیاهی است که هنگام مواجهه گیاه با تنش‌های محیطی از جمله شوری، سیستم آنتی‌اکسیداتیو در گیاه را فعال نموده و در تقویت غشای سلولی و خنثی کردن خطر افزایش مقدار اکسیژن فعال موثر است. در پژوهش حاضر به منظور بررسی تأثیر سالیسیلیک اسید در کاهش اثرات منفی تنش شوری، الگوی بیان ژن‌های TaWRKY10  و TaWRKY53 در شرایط تیمار با کلرید سدیم و سالیسیلیک اسید به صورت همزمان نیز مورد بررسی قرار گرفت. نتایج نشان داد که در هر دو رقم، میزان بیان ژن­ TaWRKY10 تحت تیمار همزمان کلرید سدیم و سالیسیلیک اسید نسبت به حالت تیمار تنها با سدیم کلرید افزایش بیان نشان داد، ولی میزان بیان ژن WRKY53 روندی کاهشی داشت. در مطالعات بر روی گیاه مدل آرابیدوپسیس نشان داده شد که بیان ژن WRKY53تأثیر منفی در مقاومت به تنش‌های محیطی از جمله شوری و خشکی دارد (Sun and Yu, 2015)، همچنین دیگر محققین نشان دادند که این ژن در تجزیه رنگدانه‌ها و تسریع پیری نقش دارد (Ay et al., 2009; Miao and Zentgraf, 2010 ). بنابراین به نظر می‌رسد که افزایش بیان  ژن WRKY53 در ارقام حساس تحت تنش شوری و کاهش بیان تحت تأثیر توأم تیمار سدیم کلرید و سالیسیلیک اسید  ناشی از تأثیر منفی آن در مقاومت به تنش‌های محیطی از جمله شوری در گندم باشد (Miao and Zentgraf, 2007). کاربرد سالیسیلیک اسید می‌تواند باعث کاهش بیان ژن WRKY53 شده و احتمالا کاهش خطرات آن را جبران کند. به طور کلی با توجه به نتایج بدست آمده، به نظر می‌رسد که کاربرد سالیسیلیک اسید بتواند در گندم باعث افزایش سازگاری به تنش شوری شود.

در راستای به کارگیری اصلاح ژنتیکی و روش‌های نوین بیوتکنولوژی تحقیقاتی نیز در دیگر گونه‌های غلات انجام شده است. از جمله آنها می‌توان به مطالعات Du و همکاران (2013). اشاره کرد که در آزمایشات خود نشان دادند که بیش بیان ژن TaSIP در برنج و آرابیدوپسیس (Arabidopsis thaliana) می‌تواند منجر به القاء مقاومت به شوری و خشکی ­شود. همچنین Chen و همکاران (2007) با جداسازی و بررسی بیان ژن OsNHX1  از برنج، گزارش کردند که این ژن باعث افزایش قابل توجهی در بهبود تحمل به تنش شوری در برنج آپلند می‌شود. He و همکاران نیز (2011) در مطالعات خود با جداسازی فاکتور رونویسی TaMYB73 از گندم و انتقال آن به گیاه آرابیدوپسیس نشان دادند که بیش بیان این ژن مقاومت به شوری را در گیاه آرابیدوپسیس بهبود می‌بخشد. چندین مطالعه دیگر نیز به بررسی الگوی بیان ژن‌ها یی که دارای نقش مهم در ایجاد مقاومت در گیاهان در شرایط تنش شوری هستند، پرداخته اند و این نقش آنها را با انتقال به گیاهان دیگر ثابت کرده اند (Huang et al., 2003; GAO et al., 2010; Huang et al., 2012; Wang et al., 2013; Guan et al., 2003).

 

نتیجه‌گیری کلی

به طور کلی این مطالعات نشان می‌دهند که برخی ژن‌ها از جمله فاکتورهای رونویسی نقش مهمی در بهبود و اصلاح گیاهان در مقاومت به شوری دارند. در خاتمه می‌توان نتیجه گرفت که نتایج این تحقیق در راستای تایید نقش فاکتورهای رونویسی در مقاومت به شوری مورد توجه است و در ایجاد و معرفی ارقام گندم مقاوم می‌تواند به کار گرفته شود.

 

تشکر و قدردانی:  از دانشگاه کردستان جهت تامین هرینه انجام این تحقیق قدردانی می‌شود

Apel, K. Hirt, H. 2004. Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Plant Biology, 55:373-399.

Ay, N. Irmler, K. Fischer, A. Uhlemann, R. Reuter, G. Humbeck, K. 2009. Epigenetic programming via histone methylation at WRKY53 controls leaf senescence in Arabidopsis thaliana. Plant Journal, 58(2):333-346.

Bezrukova, M, Sakhabutdinova, V. Fatkhutdinova, R. Kyldiarova, R. A. Shakirova, I. Sakhabutdinova, F. A. 2001. The role of hormonal changes in protective action of salicylic acid on growth of wheat seedlings under water deficit. Agrochemiya, 2: 51-54.

Chen, H. An, R. Tang, J. H. Cui, X. H. Hao, F. S. Chen, J. Wang, X. C. 2007. Over-expression of a vacuolar Na+/H+ antiporter gene improves salt tolerance in an upland rice. Molecular Breeding, 19: 215-225.

Cushman, J. Bohnert, H. J. 2000. Genomic approaches to plant stress tolerance. Plant Biology, 3:117-124.

Du, H.Y. Shen, Y.Z. Huang, Z. J. 2013. Function of the wheat TaSIP gene in enhancing drought and salt tolerance in transgenic Arabidopsis and rice. Plant Molecular Biology, 81(4-5):417-429.

El-Tayeb, M. A. 2005. Response of barley grain to the interactive effect of salinity and salicylic acid. Plant Growth Regulation, 45(3): 215-224.

Eulgem, T. Rushton, P. J. Robatzek, S. Somssich, I. E. 2000. The WRKY superfamily of plant transcription factors. Trends in Plant Sciences, 5: 199-206.

Eulgem, T. Somssich, I. E. 2007. Networks of WRKY transcription factors in defense signaling. Plant Biology, 10:366-371.

FAO, 2008. Assessment of the World Food Security and Nutrition Situation. Committee on world food security, Thirty-fourth session, Rome.

Gao, Z. He, X. Zhao, B. Zhou, C. 2010. Overexpressing a putative aquaporin gene from wheat, TaNIP enhances salt tolerance in transgenic Arabidopsis. Plant Cell Physiology, 51: 767-775.

Gaspar, T.  Franck, T. Bisbis, B. Kevers, C. Jouve, L. Hausman, J.F.  Dommes, J. 2002. Concepts in plant stress physiology. Application to plant tissue cultures. Plant Growth Regulation, 37, (3)263-285.

Guan, R. Qu, Y. Guo, Y. Yu, L. Liu, Y. Jiang, J. Chen, J. Ren, Y. Liu, G. Tian, L. Jin, L. Liu, Z. Hong, H. Chang, R. Gilliham, M. Qiu, L. 2014. Salinity tolerance in soybean is modulated by natural variation in GmSALT3. Plant Journal, 80(6):937-50.

He, Y. Li, W. Lv, J. Jia, Y. Wang, M. Xia, G. 2011. Ectopic expression of a wheat MYB transcription factor gene, TaMYB73, improves salinity stress tolerance in Arabidopsis thaliana. Journal of Experimental Botany, 63: 1511-1522.

Hoekstra, F. A. Golovina, E. A. Buitink, J. 2001. Mechanisms of plant desiccation tolerance. Plant Sciences, 6:431-438.

Huang, Z. J. Xu, T. Xue, Y. B. Shen, Y. Z. 2003. Isolation and characterization of TaGSK1 involved in wheat salt tolerance. Plant Sciences, 165: 1369-1375.

Huang, X. Zhang, Y. Jiao, B. Chen, G. Huang, S. Guo, F. Shen, Y. Huang, Z. Zhao, B. 2012. Overexpression of the wheat salt tolerance-related gene TaSC enhances salt tolerance in Arabidopsis. J. Exp. Bot. 63(15): 5463-5473.

Ishihama, N. Yoshioka, H. 2012. Post-translational regulation of WRKY transcription factors in plant immunity. Plant Biology,15: 431-437.

Kibbe, W. A. 2007. OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Research, 35(webserver issue).

Nakashima, K. Ito, Y. Yamaguchi, K. 2009. Transcriptional regulatory networks in response to abiotic stresses in Arabidopsis and grasses. Plant Physiology. 149:88-95.

Miao, Y. Zentgraf, U. 2007. The antagonist function of Arabidopsis WRKY53 and ESR/ESP in leaf senescence is modulated by the jasmonic and salicylic acid equilibrium. Plant Cell, 19(3):819-830.

Miao, Y. Zentgraf, U. 2010. A HECT E3 ubiquitin ligase negatively regulates Arabidopsis leaf senescence through degradation of the transcription factor WRKY53. Plant Journal, 63(2):179-188.

Nimwegen E. 2003. Scaling laws in the functional content of genomes. Trends in Genetics, 19(9):479-84.

Parida, A. K. Das, A. B. Mohanty, P. 2004. Defense potentials to NaCl in a mangrove, Bruguiera parviflora: differential changes of isoforms of some antioxidative enzymes. Journal of Plant Physiology, 161:531-542.

Pearson, G. Robinson, F. Beers Gibson, T. Xu, B. E. Karandikar, M. Berman, K. Cobb, M.H. 2001. "Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions". Endocrine Reviews. 22 (2): 153-83. 

Prasad M. V. 1996. Plant Ecophysiology. John Wiley and Sons, Inc, New York.

Rahaie, M. Gomarian, M. Alizadeh, H. Malboobi, M. A. Naghavi, M. R. 2011. The expression analysis of transcription factors under long term salt stress in tolerant and susceptible wheat (Triticum aestivum L.) genotypes using Reverse Northern Blot. Iranian Journal of Crop Sciences, 29: 835-844.

Rushton, P. J. Somssich, I. E. Ringler, P. Shen, Q. J. 2010. WRKY transcription factors. Trends in Plant Science,
15: 247-258.

Shewry, P. R. 2009. Wheat. Journal of Experimental Botany, 60: 1537-1553.

Sun, Y. Yu, D. 2015. Activated expression of AtWRKY53 negatively regulates drought tolerance by mediating stomatal movement. Plant Cell reports, 34: 1295-1306.

Untergasser, A. Cutcutache, I. Koressaar, T. Ye, J.,Faircloth, B. C. Remm, M. Rozen, S. G., 2012. Primer3—new capabilities and interfaces. Nucleic Acids Research, 40: e115–e115.

Xiaomu, N. Ray, A. Bressan, P. M. José M. 1995. Ion Homeostasis in NaCl Stress Environments. Plant Physiology, 109: 735-742.

Wang, C. Deng, P., Chen, L. Wang, X. Ma, H. Hu, W. Yao, N. Feng, Y. Chai, R. Yang, G. He, G. 2013. A Wheat WRKY Transcription Factor TaWRKY10 Confers Tolerance to Multiple Abiotic Stresses in Transgenic Tobacco. PLoS ONE. 8(6):1356-1371.

Zhou, Q.Y. Tian, A. G. Zou, H. F, Xie, Z. M. Lei, G. Huang, J. Wang, C. M. Wang, H. W Zhang, J. S. Chen, S. Y.2008. Soybean WRKY-type transcription factor genes, GmWRKY13, GmWRKY21, and GmWRKY54, confer differential tolerance to abiotic stresses in transgenic Arabidopsis plants. Plant Biotechnology Journal, 6(5):486-503.